Agrobacterium-Mediated Capsicum annuum Gene Editing in Two Cultivars, Hot Pepper CM334 and Bell Pepper Dempsey

International Journal of

Molecular Sciences

Article

Agrobacterium-Mediated Capsicum annuum Gene Editing in

Two Cultivars, Hot Pepper CM334 and Bell Pepper Dempsey

Sung-il Park

, Hyun-Bin Kim

, Hyun-Ji Jeon

and Hyeran Kim

1,2,



 

Citation: Park, S.-i.; Kim, H.-B.; Jeon,

H.-J.; Kim, H. Agrobacterium-Mediated

Capsicum annuum Gene Editing in

Two Cultivars, Hot Pepper CM334

and Bell Pepper Dempsey. Int. J. Mol.

Sci. 2021, 22, 3921. https://doi.org/

10.3390/ijms22083921

Academic Editors: Ki-Hong Jung and

Jae-Yean Kim

Received: 28 February 2021

Accepted: 7 April 2021

Published: 10 April 2021

Publisher’s Note: MDPI stays neutral

with regard to jurisdictional claims in

published maps and institutional afﬁl-

iations.

Licensee MDPI, Basel, Switzerland.

This article is an open access article

distributed under the terms and

conditions of the Creative Commons

Attribution (CC BY) license (https://

creativecommons.org/licenses/by/

4.0/).

Interdisciplinary Graduate Program in BIT Medical Convergence, Kangwon National University,

Chuncheon 24341, Korea; [email protected]

Department of Biological Sciences, Kangwon National University, Chuncheon 24341, Korea;

[email protected] (H.-B.K.); [email protected] (H.-J.J.)

* Correspondence: [email protected]

Abstract:

Peppers (Capsicum annuum L.) are the most widespread and cultivated species of Solanaceae

in subtropical and temperate countries. These vegetables are economically attractive worldwide.

Although whole-genome sequences of peppers and genome-editing tools are currently available, the

precision editing of peppers is still in its infancy because of the lack of a stable pepper transformation

method. Here, we employed three Agrobacterium tumefaciens strains—AGL1, EHA101, and GV3101—

to investigate which Agrobacterium strain could be used for pepper transformation. Hot pepper

CM334 and bell pepper Dempsey were chosen in this study. Agrobacterium tumefaciens GV3101

induced the highest number of calli in cv. Dempsey. All three strains generated similar numbers

of calli for cv. CM334. We optimized a suitable concentration of phosphinothricin (PPT) to select a

CRISPR/Cas9 binary vector (pBAtC) for both pepper types. Finally, we screened transformed calli

for PPT resistance (1 and 5 mg/L PPT for cv. CM334 and Dempsey, respectively). These selected

calli showed different indel frequencies from the non-transformed calli. However, the primary

indel pattern was consistent with a 1-bp deletion at the target locus of the C. annuum MLO gene

(CaMLO2). These results demonstrate the different sensitivity between cv. CM334 and Dempsey

A. tumefaciens

-mediated callus induction, and a differential selection pressure of PPT via pBAtC

binary vector.

Keywords: CRISPR/Cas9; pBAtC binary vector; CaMLO2; Capsicum annuum CM334;

Capsicum annuum Dempsey; Agrobacterium tumefaciens

1. Introduction

Owing to global climate change and the increase in participation of the older adult pop-

ulation in agriculture, facility agriculture is gaining importance. Its practice has increased

worldwide. To improve sustainability, horticulture facilities are shifting to conventional

plant–microbe interactions, resulting in several newly emerging plant diseases, such as

powdery mildew infection in tomato and pepper [

]. Symptoms of the infection can

be macroscopically observed as white-covered epithelial mycelia of powdery mildew

pathogens on leaves and fruits [

]. Some biotrophic plant pathogens, including powdery

mildew fungi, display properties that pose challenges to conventional infection preven-

tion methods, such as protectant fungicides, so resistant cultivars are needed. Powdery

mildew resistance conferred by mildew resistance locus O (MLO) genes has been reported

in various plant species, such as barley, Arabidopsis, and wheat [3–5].

Whole-genome sequences of peppers have been available since 2014 [

]. We have

discovered that peppers have extended resistance genes compared to other species in

Solanaceae [

]. Recently, we reported CRISPR/RNPs-based precise Capsicum annuum

MLO gene (CaMLO2) editing in both callus-derived protoplasts and leaf protoplasts from

hot pepper and bell peppers [

]. However, to date, we do not have pathogen-resistant

pepper plants in which a speciﬁc gene is edited.

Int. J. Mol. Sci. 2021, 22, 3921. https://doi.org/10.3390/ijms22083921 https://www.mdpi.com/journal/ijms

Int. J. Mol. Sci. 2021, 22, 3921 2 of 12

Many plant-transformation studies have been performed with

Agrobacterium tumefaciens

as nature’s genetic engineer [

]. T-DNA binary vector systems in A. tumefaciens are

the critical players for transforming plants. The T-DNA was engineered by deleting the

oncogenes and the opine synthase genes to harness effective horizontal gene transfer from

Agrobacterium to plants, effectively disarming the virulent strains so that tumors are not

to induced [

]. Several non-oncogenic recombinant Agrobacterium strains currently

popular in plant biotechnology include LBA4404, GV3101::pMP90, AGL1, EHA101, and its

derivative strain, EHA105 [

]. As representative vegetables in Solanaceae, both tobacco

and tomato have well-established Agrobacterium-mediated stable transformation systems,

to conduct horticultural research and produce valuable cultivars for the horticultural

industry [

–

]. However, Capsicum, another important genus of Solanaceae, is recalcitrant

to transformation applied using advanced plant biotechnologies and still highly dependent

on traditional breeding combined with molecular breeding [10,23].

Among the ﬁve domesticated species of Capsicum—C. annuum, C. baccatum,

C. chinense

C. frutescens, and C. pubescens [

]—C. annuum is the most common and extensively culti-

vated pepper. These peppers are grouped into hot pepper and bell pepper that provide

ﬂavor, various pungency levels, and a variety of nutrients [

]. Although various trans-

formation methods have been used in peppers, there are only a few successful cases,

such as forming a callus-induced shoot with an inbred line, pepper cotyledon-derived or

hypocotyl-derived

in vitro

regeneration methods, and developing Phytophthora-resistant

transgenic

C. annuum

cv. Mesilla Cayenne plants [

–

]. Therefore, to improve pepper

transformation, it is essential to apply the most appropriate breeding technologies [

–

Some of the factors affecting the efﬁciency of Agrobacterium strains in transforming tissues

is the type of strain, for instance, octopine (LBA4404), succinamopine (AGL1 and EHA105),

nopaline (EHA101, GV3101), and the vector [

–

], so it is crucial to validate which

Agrobacterium strain is optimal for desired crops and their cultivars. For example, EHA101

and LBA4404 showed higher transformation efﬁciencies for local pepper genotypes Balady

and Anaheim chile than GV3101 [

]. Although it is pivotal to validate the Agrobacterium

strain harboring CRISPR tools so that successfully edited peppers can be obtained, there is

still a lack of a sustainable pepper transformation system using CRISPR tools.

Here, we employed three strains of A. tumefaciens—AGL1, EHA101, and GV3101—to

investigate which Agrobacterium strain could be used for pepper transformation. The

whole-genome-sequenced hot pepper CM334 and bell pepper Dempsey were chosen in

this study. Pepper cultivars are known to have different sensitivities to various selection

markers [

]. Thus, we evaluated a suitable phosphinothricin (PPT) concentration to select

the pBAtC binary vector harboring pepper transformants and analyzed CaMLO2, the target

gene.

2. Results

2.1. Vector Construction and Agrobacterium-Mediated Transformation

We employed a pBAtC binary vector having a whole CRISPR/Cas9 cassette to edit a target

gene in hot pepper and bell pepper [

]. Using a DNA-free, CRISPR/guide RNA screening

system, we have previously selected an effective sgRNA1 (5

-ACATCTTCATCTGCCTTACA-

) to target the CaMLO2 gene in both cv. CM344 and Dempsey [

]. Using Aar1 sites, we

constructed a pBAtC:CaMLO2–sgRNA1 vector and confirmed the guide RNA sequence using

Sanger sequencing (Figure 1). To identify an effective Agrobacterium strain for hot pepper and

bell pepper, the validated pBAtC:CaMLO2–sgRNA1 vector was transformed into each of three

A. tumefaciens strains: AGL1, EHA101, and GV3101.

Int. J. Mol. Sci. 2021, 22, 3921 3 of 12

Int.J.Mol.Sci.2021,22,3921 3 of 12



Figure1.CaMLO2sgRNA1clonedpBAtCbinaryvector.(a)DescriptionofapBAtCbinaryvector.RB,rightborder;Ter,

tetracycline; CAS9hc:NLS:HA, human‐codon‐optimized Cas9 with the nuclear localizationsignaland an HA epitope;

35S,cauliflowermosaicvirus(CaMV)35Spromoter;AtU6,ArabidopsisthalianaU6promoter;Aar1,sgRNAcloning

sites

withtwo Aar1;sgRNA‐s,theguideRNA ‐scaffoldfor Cas9;Nos, nospromoter; Bas‐R, BASTAresistancegene;LB,left

border;(b)DescriptionofapBAtC:CaMLO2–sgRNA1binaryvector.Green,thesgRNA1sequenceofCaMLO2targetlocus;

Blue,overhangsdigestedbyAar1sites.

2.2.ComparisonofAgrobacterium‐MediatedCallusInductionincv.DempseyandCM334

Wepreviouslyreportedleaf‐induced calluslines fromhotpepperCM334andbell

pepperDempseyforinvitrotissuecultureandcellbiologicalresearch[41].Therefore,we

adaptedthesepepper‐leaf‐inducedcalliforthecurrentstudy.Wetook

leafexplantsfrom

both cv. CM334 and Dempsey for Agrobacterium‐mediated transformations using three

differentAgrobacteriumstrains(AGL1,EHA101,GV3101).Weanalyzedatotalof265leaf

explantsofcv.Dempsey (86withAGL1,92withEHA101,87withGV3101),and328leaf

explantsofcv.CM334(119withAGL1,

103withEHA101,106withGV3101).TheAgro‐

bacterium‐mediatedcallusinductionnumbersproducedbyallthreeAgrobacteriumstrains

studiedinthetwotypesofpepperaresummarizedinTableS1.Numbersofinducedcalli

(largerthan2.5mm)ofthetransformantsweremeasuredfor4weeks.Callusinduction

frequenciesof

sixtoeightbiologicalreplicatesforeachofthethreeAgrobacteriumstrains

were analyzed. In cv. Dempsey, GV3101 generated an average of 2.7 calli per explant,

morethanEHA101with0.6calli/explantandAGL1with0.7calli/explant(Figure2a).In

cv.CM334,theaveragenumber ofcalli(2.6withAGL1,

2.2with EHA101,and1.9with

GV3101)wassimilaramongthethreestrains(Figure2b).Therefore,GV3101hadthebest

callus‐inducingactivityforcv.Dempsey.For cv. CM334,allthreeAgrobacteriumstrains

hadcomparablecallus‐inducingactivities.Theseresultssuggestthatthecallusinduction

ratebyanAgrobacteriumstraincan

differdependingonthepeppercultivar.

2.3.SuitablePhosphinothricin(PPT)ConcentrationforScreeningTransformantsincv.

DempseyandCM334

Peppershavedifferentsensitivitiestovariousselectionmarkers,rangingfrom0.05

mg/Lmethotrexateand1mg/LPPTto25mg/Lhygromycin[39].Weexaminedtheproper

selectionpressureby PPT on

calliinducedbypBAtCintransgenic hotpepperand bell

pepper.WetestedvariousconcentrationsofPPT(0.5,1,3,5,10mg/L)forcv.Dempsey

andCM334.Incv.Dempsey,theleavestreatedwith3mg/LPPTwerenotbrowned.They

showedlesscallusinductionthanleavestreatedwithoutPPT.

However,aftertreatment

with 5 mg/L PPT, leaf explants were partially brown, and no callus had been induced

(Figure3ac).Bycontrast,cv.CM334leavestreatedwith0.5mg/LPPTwerealreadypar‐

tiallybrowned,andcallusrarelyemerged(Figure3e).Inthepresenceof1mg/LPPT,cv.

CM334leaveswerecompletelybrownwithoutinducedcallus(Figure3f). Theseresults

Figure 1.

CaMLO2 sgRNA1 cloned pBAtC binary vector. (

) Description of a pBAtC binary vector. RB, right border; Ter,

tetracycline; CAS9hc:NLS: HA, human-codon-optimized Cas9 with the nuclear localization signal and an HA epitope; 35S,

cauliﬂower mosaic virus (CaMV) 35S promoter; AtU6, Arabidopsis thaliana U6 promoter; Aar1, sgRNA cloning sites with

two Aar1; sgRNA-s, the guide RNA-scaffold for Cas9; Nos, nos promoter; Bas-R, BASTA resistance gene; LB, left border;

(

) Description of a pBAtC:CaMLO2–sgRNA1 binary vector. Green, the sgRNA1 sequence of CaMLO2 target locus; Blue,

overhangs digested by Aar1 sites.

2.2. Comparison of Agrobacterium-Mediated Callus Induction in cv. Dempsey and CM334

We previously reported leaf-induced callus lines from hot pepper CM334 and bell

pepper Dempsey for

in vitro

tissue culture and cell biological research [

]. Therefore,

we adapted these pepper-leaf-induced calli for the current study. We took leaf explants

from both cv. CM334 and Dempsey for Agrobacterium-mediated transformations using

three different Agrobacterium strains (AGL1, EHA101, GV3101). We analyzed a total

265 leaf

explants of cv. Dempsey (86 with AGL1, 92 with EHA101, 87 with GV3101),

and

328 leaf

explants of cv. CM334 (119 with AGL1, 103 with EHA101, 106 with GV3101).

The

Agrobacterium

-mediated callus induction numbers produced by all three Agrobacterium

strains studied in the two types of pepper are summarized in Table S1. Numbers of induced

calli (larger than 2.5 mm) of the transformants were measured for 4 weeks. Callus induction

frequencies of six to eight biological replicates for each of the three Agrobacterium strains

were analyzed. In cv. Dempsey, GV3101 generated an average of 2.7 calli per explant,

more than EHA101 with 0.6 calli/explant and AGL1 with 0.7 calli/explant (Figure 2a). In

cv. CM334, the average number of calli (2.6 with AGL1, 2.2 with EHA101, and 1.9 with

GV3101) was similar among the three strains (Figure 2b). Therefore, GV3101 had the best

callus-inducing activity for cv. Dempsey. For cv. CM334, all three Agrobacterium strains had

comparable callus-inducing activities. These results suggest that the callus induction rate

by an Agrobacterium strain can differ depending on the pepper cultivar.

Int. J. Mol. Sci. 2021, 22, 3921 4 of 12

Int.J.Mol.Sci.2021,22,3921 4 of 12



showed thathot pepper CM334 was more sensitive to PPT than bell pepper Dempsey

(Figure3).Iftreatedleaveswerebrownwithoutfurtherinductionofanemergingcallus

andeventuallydiedinthepresenceofPPTatacertainconcentration,thatconcentration

wasconsideredtheappropriateselectionlevel.Therefore,we

screenedcv.Dempseyusing

5mg/LPPTandused1mg/LPPTtoscreencv.CM334.



Figure2.ComparisonofcallusinductionratiosamongthethreeAgrobacteriumstrainsinAgrobac‐

terium‐mediatedtransformationoftwopeppertypes.(a)Callusinductionratiosofcv.Dempsey

bythreeAgrobacteriumstrains(AGL1,n=7biologicalreplicates(BR);EHA101,n=8BR;GV3101,n

=8BR).Totalnumberofexplantswas265.Resultsarepresentedasmean±SD;(b)Callusinduc‐

tionratiosofcv.CM334bythreeAgrobacteriumstrains(AGL1,n=9BR;EHA101,n=8BR;

GV3101,n=8BR).Totalnumberofexplantswas328.Resultsarepresentedas

mean±SD.Callus

size≥2.5mm.***,p<0.001basedonanalysisofvariance(ANOVA).



Figure 2.

Comparison of callus induction ratios among the three Agrobacterium strains in

Agrobacterium

-mediated transformation of two pepper types. (

) Callus induction ratios of cv.

Dempsey by three Agrobacterium strains (AGL1, n = 7 biological replicates (BR); EHA101, n = 8

BR; GV3101, n = 8 BR). Total number of explants was 265. Results are presented as mean

SD;

(b) Callus

induction ratios of cv. CM334 by three Agrobacterium strains (AGL1, n = 9 BR; EHA101,

n = 8 BR

; GV3101, n = 8 BR). Total number of explants was 328. Results are presented as mean

SD.

Callus size ≥2.5 mm. ***, p < 0.001 based on analysis of variance (ANOVA).

2.3. Suitable Phosphinothricin (PPT) Concentration for Screening Transformants in cv. Dempsey

and CM334

Peppers have different sensitivities to various selection markers, ranging from

0.05 mg/L

methotrexate and 1 mg/L PPT to 25 mg/L hygromycin [

]. We examined the proper

selection pressure by PPT on calli induced by pBAtC in transgenic hot pepper and bell

pepper. We tested various concentrations of PPT (0.5, 1, 3, 5, 10 mg/L) for cv. Dempsey

and CM334. In cv. Dempsey, the leaves treated with 3 mg/L PPT were not browned. They

showed less callus induction than leaves treated without PPT. However, after treatment

with 5 mg/L PPT, leaf explants were partially brown, and no callus had been induced

(Figure 3a–c). By contrast, cv. CM334 leaves treated with 0.5 mg/L PPT were already

partially browned, and callus rarely emerged (Figure 3e). In the presence of 1 mg/L PPT,

cv. CM334 leaves were completely brown without induced callus (Figure 3f). These results

showed that hot pepper CM334 was more sensitive to PPT than bell pepper Dempsey

(Figure 3). If treated leaves were brown without further induction of an emerging callus

and eventually died in the presence of PPT at a certain concentration, that concentration

was considered the appropriate selection level. Therefore, we screened cv. Dempsey using

5 mg/L PPT and used 1 mg/L PPT to screen cv. CM334.

After performing Agrobacterium-mediated pBAtC:CaMLO2-sgRNA1 transformation

in both pepper types using three different strains of Agrobacterium (AGL1, EHA101, and

GV3101), we initially obtained different numbers of induced calli larger than 2.5 mm: 30,

37, 205 for cv. Dempsey; 325, 205, 205 for cv. CM334, respectively. These induced calli

were selected for 30 days with bi-weekly subcultures on PPT media. It is noteworthy that

the initially induced calli were selected in the PPT-containing media and differentially

proliferated or decreased during the subculture processes. Therefore, we ﬁnally obtained

51, 68, and 63 calli in cv. Dempsey and 99, 52, and 65 in cv. CM334 for Agrobacterium strain

AGL1, EHA101, and GV3101, respectively.

Int. J. Mol. Sci. 2021, 22, 3921 5 of 12

Int.J.Mol.Sci.2021,22,3921 4 of 12



showed thathot pepper CM334 was more sensitive to PPT than bell pepper Dempsey

(Figure3).Iftreatedleaveswerebrownwithoutfurtherinductionofanemergingcallus

andeventuallydiedinthepresenceofPPTatacertainconcentration,thatconcentration

wasconsideredtheappropriateselectionlevel.Therefore,we

screenedcv.Dempseyusing

5mg/LPPTandused1mg/LPPTtoscreencv.CM334.



Figure2.ComparisonofcallusinductionratiosamongthethreeAgrobacteriumstrainsinAgrobac‐

terium‐mediatedtransformationoftwopeppertypes.(a)Callusinductionratiosofcv.Dempsey

bythreeAgrobacteriumstrains(AGL1,n=7biologicalreplicates(BR);EHA101,n=8BR;GV3101,n

=8BR).Totalnumberofexplantswas265.Resultsarepresentedasmean±SD;(b)Callusinduc‐

tionratiosofcv.CM334bythreeAgrobacteriumstrains(AGL1,n=9BR;EHA101,n=8BR;

GV3101,n=8BR).Totalnumberofexplantswas328.Resultsarepresentedas

mean±SD.Callus

size≥2.5mm.***,p<0.001basedonanalysisofvariance(ANOVA).



Figure 3.

Effects of PPT on selection of callus of explants transformed by three different strains of

Agrobacterium. (

a–c

) Examination of a suitable concentration of PPT for cv. Dempsey leaf explants.

Cultivar Dempsey leaf explants were placed on CIM without PPT (0 mg/mL) (

), and with PPT

3 mg/L

(

) and 5 mg/L (

); (

d–f

) Examination of a suitable concentration of PPT for cv. CM334

leaf explants. Cultivar CM334 leaf explants on CIM without PPT (0 mg/mL) (

), and with PPT at

0.5 mg/L

(

) and 1 mg/L (

) are shown. All explants on the indicated PPT medium were examined

for 10 days. Scale bars = 1 cm. PPT, phosphinothricin; CIM, callus induction medium.

2.4. Evaluation of PPT-Selected Transformants in cv. Dempsey and CM334

We also investigated whether these PPT-selected calli contained the pBAtC:CaMLO2–

sgRNA1 binary vector. Each Agrobacterium-induced callus was analyzed by PCR with

a speciﬁc primer pair—AtU6 promoter (forward) and guide RNA-scaffold (reverse)—

targeting the pBAtC binary vector sequence (Figure 4). Thus, we validated PCR-positive

pepper calli with the inserted sgRNA1 region of 362-bp in length (Figure 4). We applied

PCR to a total of 102 cv. Dempsey calli and 107 cv. CM334 calli among the PPT-selected

ones (Table 1). The percentage of PCR-positive transformants obtained from cv. Dempsey

was 79.3% with AGL1, 61.1% with EHA101, and 51.4% with GV3101 and that from cv.

CM334 was 75.7% with AGL1, 85.7% with EHA101, and 94.3% with GV3101 (Table 1).

Thus, we were able to identify the true-positive calli of both pepper types by combining

PPT selection and target-speciﬁc PCR analysis.

Table 1. Summary of the percentages of positive (PCR and PPT) transformants in cv. Dempsey and CM334.

Agrobacterium

Cultivar Dempsey CM334

Number of

PCR-Applied

Calli among

PPT Selected

Number of

PCR-Positive

Calli

Percentage of

both Positives

(PPT and PCR)

Number of

PCR-Applied

Calli among

PPT Selected

Number of

PCR-Positive

Calli

Percentage of

both Positives

(PPT and

PCR)

AGL1 29 23 79.3 37 28 75.7

EHA101 36 22 61.1 35 30 85.7

GV3101 37 19 51.4 35 33 94.3

Int. J. Mol. Sci. 2021, 22, 3921 6 of 12

Int.J.Mol.Sci.2021,22,3921 5 of 12



Figure3.EffectsofPPTonselectionofcallusofexplantstransformedbythreedifferentstrainsof

Agrobacterium.(ac)ExaminationofasuitableconcentrationofPPTforcv.Dempseyleafexplants.

CultivarDempseyleafexplantswereplacedonCIMwithoutPPT(0mg/mL)(a),andwithPPTat

3mg/L(b)and5mg/L(c);(df)ExaminationofasuitableconcentrationofPPTforcv.CM334leaf

explants.CultivarCM334leafexplantsonCIMwithoutPPT(0mg/mL)(d),andwithPPTat0.5

mg/L(e)and1mg/L(f)are

shown.AllexplantsontheindicatedPPTmediumwereexaminedfor

10days.Scalebars=1cm.PPT,phosphinothricin;CIM,callusinductionmedium.

AfterperformingAgrobacterium‐mediatedpBAtC:CaMLO2‐sgRNA1transformation

inbothpeppertypesusingthreedifferentstrainsofAgrobacterium(AGL1,EHA101,and

GV3101),weinitiallyobtaineddifferentnumbersofinducedcallilargerthan2.5mm:30,

37, 205 for cv. Dempsey; 325,205, 205for cv. CM334, respectively. These induced calli

were

selectedfor30dayswithbi‐weeklysubculturesonPPTmedia.Itisnoteworthythat

the initially induced calli were selected in the PPT‐containing media and differentially

proliferatedordecreasedduringthesubcultureprocesses.Therefore,wefinallyobtained

51,68,and63calliincv.Dempseyand99,52,and

65incv.CM334forAgrobacteriumstrain

AGL1,EHA101,andGV3101,respectively.

2.4.EvaluationofPPT‐SelectedTransformantsincv.DempseyandCM334

WealsoinvestigatedwhetherthesePPT‐selectedcallicontainedthepBAtC:CaMLO2

–sgRNA1binaryvector.EachAgrobacterium‐inducedcalluswasanalyzedbyPCRwitha

specificprimerpairAtU6promoter(forward)andguideRNA‐scaffold(reverse)tar‐

getingthepBAtCbinaryvectorsequence(Figure4).Thus,wevalidatedPCR‐positivepep‐

percalliwiththeinsertedsgRNA1regionof362‐bpin

length(Figure4).WeappliedPCR

toatotalof102cv.Dempseycalliand107cv.CM334calliamongthePPT‐selectedones

(Table1).ThepercentageofPCR‐positivetransformantsobtainedfromcv.Dempseywas

79.3%withAGL1,61.1%withEHA101,and51.4%withGV3101andthatfromcv.

CM334

was75.7%withAGL1,85.7%withEHA101,and94.3%withGV3101(Table1).Thus,we

wereabletoidentifythetrue‐positivecalliofbothpeppertypesbycombiningPPTselec‐

tionandtarget‐specificPCRanalysis.



Figure4.PCRanalysesofPPT‐selectedandtransformedcalliofcv.DempseyandCM334.(a)Calliincv.Dempseyinduced

byAgrobacteriumstrainAGL1,EHA101,andGV3101,respectively;(b)calliincv.CM334inducedbyAgrobacteriumstrain

AGL1,EHA101,and GV3101,respectively.M,100‐bpDNAladder;P,pBAtC:CaMLO2–sgRNA1binaryvector; N,non‐

transformedpepper callus.Theindicated numbers(1to 14)arethePPT‐selectedand transformedcalliincv. Dempsey

andCM334.

Figure 4.

PCR analyses of PPT-selected and transformed calli of cv. Dempsey and CM334. (

) Calli in cv. Dempsey

induced by Agrobacterium strain AGL1, EHA101, and GV3101, respectively; (

) calli in cv. CM334 induced by Agrobacterium

strain AGL1, EHA101, and GV3101, respectively. M, 100-bp DNA ladder; P, pBAtC:CaMLO2–sgRNA1 binary vector; N,

non-transformed pepper callus. The indicated numbers (1 to 14) are the PPT-selected and transformed calli in cv. Dempsey

and CM334.

2.5. Analysis of CRISPR/Cas9 Indel Frequencies of Positive Transformants in cv. Dempsey and

CM334

We ﬁnally obtained both PPT- and PCR-positive transformed calli from 35 cv. Dempsey

and 95 cv. CM334 using three different strains of Agrobacterium in Agrobacterium-mediated

transformation. The numbers of double-positive transformants obtained for cv. Dempsey

(Figure 5a, Table S2) and CM334 (Figure 5b, Table S2) were 6 and 41, 14 and 22, and 15 and

32 calli induced by Agrobacterium strain AGL1, EHA101, and GV3101, respectively. These

selected calli were extracted for the preparation of genomic DNA (gDNA) from pepper and

sequenced to investigate CaMLO2 editing by targeted deep sequencing. Indel frequency

(%) was calculated as the number of measured reads at the target locus divided by the

number of total reads. The analyzed indel frequencies of the CaMLO2 target locus from all

double-selected transformants in both pepper types are summarized in Table S2. The indel

frequency in cv. Dempsey was higher for calli transformed by Agrobacterium strain EHA101

than strains AGL1 or GV3101, with p = 0.0184 compared to control non-transformants

(Table S3). However, the differences among all three strains were marginal, with an average

frequency of 0.028% and the highest frequency of 0.07% (Figure 5a, Table S2). Cultivar

CM334 showed similar indel frequencies to cv. Dempsey, with an average frequency of

0.035% and the highest frequency of 0.09% with EHA101 (Figure 5b, Table S2). The EHA101

strain was slightly better than the AGL1 and GV3101 strains for target gene editing in cv.

CM334 (Figure 5b). The performed statistical analyses are described in Table S3.

Although the indel frequencies in the target CaMLO2 gene of transformed calli were

not as high as those shown in protoplast-based systems at more than 10%, the editing at

the target locus occurred very precisely with 1-bp deletion at the sgRNA1 locus of CaMLO2

(Figure 5c). Moreover, indel patterns at the target locus were reproducible throughout

the 130 selected double-positive transformants of cv. Dempsey and CM334 (Figure 5c).

These results demonstrate that generating a gene-edited pepper cultivar is challenging but

feasible with optimized transformation strategies and CRISPR tools.

Int. J. Mol. Sci. 2021, 22, 3921 7 of 12

Int.J.Mol.Sci.2021,22,3921 6 of 12



Table1.Summaryofthepercentagesofpositive(PCRandPPT)transformantsincv.DempseyandCM334.

Cultivar



Agrobacterium

Dempsey CM334

NumberofPCR‐

AppliedCalliamong

PPTSelected

Numberof

PCR‐Positive

Calli

Percentageofboth

Positives(PPTand

PCR)

NumberofPCR‐

AppliedCalliamong

PPTSelected

Numberof

PCR‐Positive

Calli

Percentageofboth

Positives(PPTand

PCR)

AGL1 29 23 79.3 37 28 75.7

EHA101 36 22 61.1 35 30 85.7

GV3101 37 19 51.4 35 33 94.3

2.5.AnalysisofCRISPR/Cas9IndelFrequenciesofPositiveTransformantsincv.Dempseyand

CM334

We finally obtained both PPT- and PCR-positive transformed calli from 35 cv.

Dempsey and 95 cv. CM334 using three differentstrains of Agrobacterium in Agrobacte‐

rium‐mediatedtransform a tion.Thenumbersofdouble‐positivetransformantsobtained

forcv.Dempsey(Figure5a,TableS2)andCM334(Figure5b,TableS2)were6and41,14

and22,and15and32calliinducedbyAgrobacteriumstrainAGL1,EHA101,andGV3101,

respectively. These selected calli were extracted for the preparation of genomic DNA

(gDNA)frompepperandsequencedto

investigateCaMLO2editingbytargeteddeepse‐

quencing. Indel frequency (%) was calculated as the number of measured reads at the

targetlocusdividedbythenumberoftotalreads.Theanalyzedindelfrequenciesofthe

CaMLO2 target locus from all double‐selected transformants in both pepper types are

summarized

inTableS2.Theindelfrequencyincv.Dempseywashigherforcallitrans‐

formed by Agrobacteriumstrain EHA101 thanstrainsAGL1 or GV3101, with p = 0.0184

compared to control non‐transformants(Table S3). However, the differences among all

three strains were marginal, with an average frequency of 0.028% and

 the highest fre‐

quencyof0.07%(Figure5a,TableS2).CultivarCM334showedsimilarindelfrequencies

tocv.Dempsey,withanaveragefrequencyof0.035%andthehighestfrequencyof0.09%

withEHA101(Figure5b,TableS2).TheEHA101strainwasslightlybetterthantheAGL1

andGV3101strainsfor

targetgeneeditingincv.CM334(Figure5b).Theperformedsta‐

tisticalanalysesaredescribedinTableS3.



Figure5.ComparisonofindelfrequenciesofselectedpeppercallifollowingAgrobacterium‐medi‐

atedtransformation.(a)Indelfrequenciesofselectedcv.Dempseycalli(Control,n=6;AGL1,n=

Figure 5.

Comparison of indel frequencies of selected pepper calli following Agrobacterium-mediated

transformation. (

) Indel frequencies of selected cv. Dempsey calli (Control, n = 6; AGL1, n = 6;

EHA101, n = 14; GV3101, n = 15); (

) Indel frequencies of selected cv. CM334 calli (Control,

n = 7;

AGL1, n = 41; EHA101, n = 22; GV3101, n = 32). Callus size

≥

2.5 mm. The indel frequency (%) was

calculated by dividing the number of sequencing reads containing indel at the target site by the

number of total sequencing reads. *, p < 0.05; **, p < 0.01 based on analysis of variance (ANOVA);

(

) Indel patterns of selected calli in both cv. Dempsey and CM334. Red, PAM sequence; Blue, Cas9

target sequence; Red dashed lines (-), a deleted nucleotide.

3. Discussion

Agrobacterium tumefaciens is a soilborne, pathogenic, Gram-negative bacterium that

causes plants to produce crown gall disease following the transfer, integration, and ex-

pression of oncogenes by the T-DNA region of the tumor-inducing (Ti) plasmid [

]. The

compatibilities between pepper and Agrobacterium strains are dependent on the pepper

cultivar [

]. We found that Agrobacterium GV3101 resulted in a higher callus induction rate

than AGL1 and EHA101 in pepper cv. Dempsey, whereas all three Agrobacterium strains

showed similar rates of callus induction in pepper cv. CM334. These results conﬁrmed

that both hot pepper Dempsey and bell pepper CM334 also had different compatibilities

with Agrobacterium strains. The nopaline-type A. tumefaciens GV3101 is recommended

for Arabidopsis thaliana ﬂoral-dip and root-transformation methods [

] and could thus be

assumed to be the best strain for cv. Dempsey too. However, when the pBAtC:CaMLO2–

sgRNA1 binary vector harboring Agrobacterium strains was used to infect cv. Dempsey, the

most effective strain for inducing calli in cv. Dempsey was not GV3101. This result was

validated by both PPT selection and PCR analysis. Although the GV3101 strain effectively

induced calli in cv. Dempsey, these calli were not truly transformed, but false-positively

proliferated. Therefore, the effective callus-induced strain did not correlate with the strain

having the best editing frequency.

The most desired outcome for pepper editing is to have 100% edited without any

chimera patterns of the target gene. We could not detect such a high indel frequency

among the three Agrobacterium strains tested in this study. Only marginal efﬁciency was

found. However, we determined that Agrobacterium EHA101 was the best among the tested

strains for cv. Dempsey and CM334 to obtain statistically signiﬁcant editing efﬁciency

at the target locus CaMLO2 when using at least seven biological replicates. Although

Int. J. Mol. Sci. 2021, 22, 3921 8 of 12

several disarmed Agrobacterium strains, such as LBA4404 or GV3101, are frequently used in

generating genetically modiﬁed crops, improvement of current Agrobacterium strains or

discovery of new “super-virulent” strains will be essential for recalcitrant crops, such as

hot pepper and bell pepper [42,45].

Considering that the indel frequency in the editing of both pepper types can be more

than 10% with active complexes of Cas9 protein and sgRNA1 in protoplasts [

], the

pepper genome itself is not problematic for applying CRISPR tools. We conﬁrmed that

the delivered pBAtC binary vector was detected by PCR analysis in PPT-selected calli.

However, the binary vector may not be efﬁcient enough to express Cas9 and sgRNA1, the

two key players of the CRISPR system in pepper cv. CM334 and Dempsey. Therefore,

a binary vector can be improved by a pepper-favorable CRISPR-expressing cassette to

produce more active components in peppers.

The functional relevance of CaMLO2 in the disease resistance of peppers has already

been investigated [

]. Although the genome-editing era is well underway, CaMLO2-edited

peppers are not yet available due to the recalcitrance of pepper. Therefore, it is essential

to have a conﬁrmed CRISPR delivery strategy to generate genome-edited inheritable

peppers. Here, we demonstrate that A. tumefaciens strain EHA101 is the most optimal one

to transform hot pepper CM334 and bell pepper Dempsey among the three A. tumefaciens

tested (AGL1, EHA101, and GV3101). Based on the conﬁrmed efﬁcacy of sgRNA1 for the

CaMLO2 gene, we successfully delivered the CRISPR/Cas9 binary vector system called

pBAtC:CaMLO2–sgRNA1 into cv. CM334 and Dempsey. We provide proper concentrations

of PPT as a selective marker of pBAtC at 1 mg/L for cv. CM334 and 5 mg/L for cv.

Dempsey.

4. Materials and Methods

4.1. Plant Materials

Hot pepper, C. annuum cv. CM334 (Criollo de Morelos 334), a landrace collected

from the Mexican state of Morelos [

], and bell pepper, C. annuum cv. Dempsey, a cultivar

originating from a three-way cross between PI163192, PI264281, and Jupiter cultivars [

were provided by the Vegetable Breeding Research Center (VBRC) in Seoul, the Republic

of Korea. Pepper leaf explants were used from 6-week-old C. annuum L. cv. Dempsey

and CM334 for Agrobacterium-mediated transformation. Pepper seeds were sterilized

with 2% commercial bleach and 0.1% Tween-20 for 20 min and washed three times with

distilled water for 10 min each time. These surface-sterilized seeds were germinated on

Murashige-Skoog (MS) medium with vitamins (Duchefa Biochemie, Haarlem, Nether-

lands), 2% sucrose, and 0.8% phytoagar with pH adjusted to 5.8. These sowed plates were

incubated at 25

◦

C for 1 week in the dark. Germinated pepper seedlings were grown at

◦

with 60% humidity under 16 h light and 8 h dark photoperiods in a growth chamber

(HANKUK S&I, Korea) for 5 weeks.

4.2. Plasmid Construction

The target locus of the CaMLO2 gene from both pepper types, sgRNA1 (5

-ACATCTTCATC

TGCCTTACA-3

), was screened using a DNA-free CRISPR/guide RNA screening system [

The selected sgRNA1 was cloned into a pBAtC vector via Aar1 sites [

]. The cloned sgRNA1

sequence was confirmed by Sanger sequencing (Macrogen, Seoul, Korea).

4.3. Agrobacterium-Mediated Transformation

Cloned binary pBAtC:CaMLO2–sgRNA1 vector was transformed into each strain of A.

tumefaciens AGL1, EHA101, and GV3101. These three strains were incubated in 4 mL YEB,

containing 50 mg/L spectinomycin and 25 mg/L rifampicin for 48 h to obtain seed culture.

As the main culture, 100 mL YEB (50 mg/L spectinomycin, 25 mg/L rifampicin) was

inoculated with 2 mL of each seed culture and incubated at 28

◦

C with shaking at

180 rpm

overnight to obtain an optical density at 600 nm (OD

600

) of 1.0. After overnight growth,

these three strains were diluted to OD

600

of 0.3 using harvest buffer (2.2 g/L MS medium

Int. J. Mol. Sci. 2021, 22, 3921 9 of 12

including vitamins, 0.9 mg/L thiamin, 39 mg/L acetosyringone, 1% sucrose, pH 5.8) for

co-cultivation. Leaf explants (1.5

1.5 cm) were placed in the Agrobacterium suspension

and co-cultured at 25

◦

C and 60% humidity for 30 min. Leaf explants were removed, wiped

thoroughly with 3M paper, and then cultured on 3M paper wetted with the harvest buffer

for 48 h at 25

◦

C and 60% humidity in the dark.

4.4. Callus Induction

Co-cultured explants were placed on a callus induction medium (CIM) (for cv. Dempsey:

2.4 g/L MS medium basal salt mixture including MES buffer, 0.4 mg/L thiamin, 0.1 g/L

myo-inositol, 3% sucrose, 0.8% phytoagar, 500 mg/L cefotaxime, pH 5.8; for cv. CM334:

3.1 g/L Gamborg’s B5 medium including vitamins, 0.5 g/L MES monohydrate, 2.0 mg/L

6-benzylaminopurine, 1.0 mg/L of 1-naphthaleneacetic acid, 3% sucrose, 0.8% phytoagar,

500 mg/L cefotaxime, pH 5.8 [

]. The number of induced calli (larger than 2.5 mm) among

the transformants was measured for 4 weeks and analyzed for callus induction.

4.5. Antibiotic Selection

PPT (Duchefa Biochemie, Haarlem, Netherlands) was dissolved in deionized water to

10 mg/mL as a stock and sterilized by ﬁltration through a 0.2

m ﬁlter (Satorius, Sungnam,

Korea). The indicated concentration of PPT in the PPT-included CIM for either cv. Dempsey

or CM334 was freshly prepared before the co-cultivating leaf explants. Co-cultivated leaves

were placed on the PPT-included CIM for 10 days. Negative transformants were observed

to have browned leaves with rare emerging calli that eventually died in the presence of

PPT for 10 days. Positive transformants were detected if there was proliferative callus at

the diced edge of leaf explants.

4.6. Genomic DNA (gDNA) Extraction from Pepper and PCR Analysis

gDNA of both pepper types was extracted from selected calli by the CTAB method [

To validate the existence of the pBAtC:CaMLO2–sgRNA1 vector in selected calli, we used a

speciﬁc pair of primers—forward (5

-GAATGATTAGGCATCGAACC-3

) and reverse (5

AAAAAAGCACCGACTCGG-3

)—to amplify the inserted sgRNA1 region with a length

of 362 bp.

4.7. Targeted Deep Sequencing

The indel frequency and patterns of pepper transformants were analyzed by targeted

deep sequencing [

]. The gDNA was extracted from pepper transformants and non-

transformants of both pepper types and ampliﬁed with speciﬁc primers (Table 2) to read

the target CaMLO2 locus in cv. CM334 and Dempsey. The gDNA was used to construct the

target amplicon libraries by consecutive PCRs to add multiplexing indices and sequencing

adaptors. The amplicon library was sequenced using the Illumina MiSeq V2 Reagent

Kit (300-cycle; San Diego, CA, USA) to monitor indels at the target locus. Raw data of

paired-end MiSeq were analyzed by running Cas-Analyzer (http://www.rgenome.net/

cas-analyzer/#! accessed on 5 April 2021), a CRISPR RGEN tool for assessing genome

editing results using next-generation sequencing data [

]. The indel frequency (%) was

calculated by dividing the number of sequencing reads containing indel at the target site by

the number of total sequencing reads. The indel patterns at the target CaMLO2 locus were

retrieved from the sequenced raw data of transformants from both pepper types analyzed.

4.8. Statistical Analysis

Presented data were statistically analyzed using GraphPad Prism 8.0. (San Diego, CA,

USA) The signiﬁcance of the data was investigated through a t-test or analysis of variance

(ANOVA) (*, p < 0.05; **, p < 0.01, ***, p < 0.001).

Int. J. Mol. Sci. 2021, 22, 3921 10 of 12

Table 2. Primers used in targeted deep sequencing.

Primer Sequence

CaMLO2 F ATGGCTAAAGAACGGTCGAT

CaMLO2 R ATGGAGCTGGTGTATTGCAT

Primary F TGGGATTCATATCATTGTTGTTG

Primary R CCGAATGTGTCTCAGCCTTT

Secondary F

ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGGATTCATATCATTGTTGTTG

Secondary R ACTGGAGTTCAGAGTGTGCTCTTCCGATCTCCGAATGTGTCTCAGCCTTT

F; forward; R, reverse.

Supplementary Materials:

The following are available online at https://www.mdpi.com/article/

10.3390/ijms22083921/s1, Table S1: The summary of three Agrobacterium strains-mediated callus

induction in Dempsey and CM334, Table S2: The summary of indel frequencies of CaMLO2 sgRNA1

locus from all transformants of Dempsey and CM334, Table S3: The summary of statistical analyses

of CaMLO2 edited transformants in Dempsey and CM334 peppers.

Author Contributions:

Conceptualization, H.K.; methodology, H.K., S.-i.P., H.-B.K., and H.-J.J.;

investigation, S.-i.P., H.-B.K., and H.-J.J.; data curation, S.-i.P.; writing, S.-i.P. and H.K.; supervision,

H.K.; project administration, H.K.; funding acquisition, H.K. All authors have read and agreed to the

published version of the manuscript.

Funding:

This research was supported by the New Breeding Technologies Development Program

(Project No. PJ01477602), Rural Development Administration (RDA), and the Basic Science Research

Program, grant number NRF-2018R1A2B6006233, of the National Research Foundation of Korea to

H.K.; the Korea Foundation for the Advancement of Science & Creativity (KOFAC), and funded by

the Korean Government (MOE) to S.P., H.-B.K., and H.-J.J.

Institutional Review Board Statement: Not applicable.

Informed Consent Statement: Not applicable.

Data Availability Statement: All data supporting reported results can be found in the article.

Acknowledgments:

We are grateful to Byoungcheorl Kang of Seoul National University and the

Vegetable Breeding Research Center for sharing two peppers, CM334 and Dempsey. We appreciate

the technical contributions provided by Min Kyung Choi and Kyoungmi Kim of Korea University.

Conﬂicts of Interest:

The authors declare no conﬂict of interest. The funders had no role in the design

of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or

in the decision to publish the results.

References

Elad, Y.; Messika, Y.; Brand, M.; David, D.R.; Sztejnberg, A. Effect of colored shade nets on pepper powdery mildew

(Leveillula taurica). Phytoparasitica 2007, 35, 285–299. [CrossRef]

Lyngkjær, M.F.; Newton, A.C.; Atzema, J.L.; Baker, S.J. The Barley mlo-gene: An important powdery mildew resistance source.

Agronomie 2000, 20, 745–756. [CrossRef]

Acevedo-Garcia, J.; Gruner, K.; Reinstädler, A.; Kemen, A.; Kemen, E.; Cao, L.; Takken, F.L.W.; Reitz, M.U.; Schäfer, P.;

O’Connell, R.J.;

et al. The powdery mildew-resistant Arabidopsis mlo2 mlo6 mlo12 triple mutant displays altered infection

phenotypes with diverse types of phytopathogens. Sci. Rep. 2017, 7, 9319. [CrossRef]

Büschges, R.; Hollricher, K.; Panstruga, R.; Simons, G.; Wolter, M.; Frijters, A.; van Daelen, R.; van der Lee, T.; Diergaarde, P.;

Groenendijk, J.; et al. The barley mlo gene: A novel control element of plant pathogen resistance. Cell

1997

, 88, 695–705. [CrossRef]

Wang, Y.; Cheng, X.; Shan, Q.; Zhang, Y.; Liu, J.; Gao, C.; Qiu, J.L. Simultaneous editing of three homoeoalleles in hexaploid bread

wheat confers heritable resistance to powdery mildew. Nat. Biotechnol. 2014, 32, 947–951. [CrossRef] [PubMed]

Qin, C.; Yu, C.; Shen, Y.; Fang, X.; Chen, L.; Min, J.; Cheng, J.; Zhao, S.; Xu, M.; Luo, Y.; et al. Whole-genome sequencing of

cultivated and wild peppers provides insights into Capsicum domestication and specialization. Proc. Natl. Acad. Sci. USA

2014

111, 5135–5140. [CrossRef] [PubMed]

Kim, S.; Park, M.; Yeom, S.I.; Kim, Y.M.; Lee, J.M.; Lee, H.A.; Seo, E.; Choi, J.; Cheong, K.; Kim, K.T.; et al. Genome sequence of

the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat. Genet.

2014

, 46, 270–278. [CrossRef]

[PubMed]

Int. J. Mol. Sci. 2021, 22, 3921 11 of 12

Seo, E.; Kim, S.; Yeom, S.I.; Choi, D. Genome-wide comparative analyses reveal the dynamic evolution of nucleotide-binding

Leucine-rich repeat gene family among Solanaceae plants. Front. Plant Sci. 2016, 7, 1205. [CrossRef]

Kim, S.; Park, J.; Yeom, S.I.; Kim, Y.M.; Seo, E.; Kim, K.T.; Kim, M.S.; Lee, J.M.; Cheong, K.; Shin, H.S.; et al. New reference genome

sequences of hot pepper reveal the massive evolution of plant disease-resistance genes by retroduplication. Genome Biol.

2017

, 18,

210. [CrossRef]

10.

Kim, H.; Choi, J.; Won, K.H. A stable DNA-free screening system for CRISPR/RNPs-mediated gene editing in hot and sweet

cultivars of Capsicum annuum. BMC Plant Biol. 2020, 20, 449. [CrossRef]

11. Nester, E.W. Agrobacterium: Nature’s genetic engineer. Front. Plant Sci. 2015, 5, 730. [CrossRef]

12. Kyndt, T.; Quispe, D.; Zhai, H.; Jarret, R.; Ghislain, M.; Liu, Q.; Gheysen, G.; Kreuze, J.F. The genome of cultivated sweet potato

contains Agrobacterium T-DNAs with expressed genes: An example of a naturally transgenic food crop. Proc. Natl. Acad. Sci. USA

2015, 112, 5844–5849. [CrossRef] [PubMed]

13.

Fraley, R.T.; Rogers, S.G.; Horsch, R.B.; Sanders, P.R.; Flick, J.S.; Adams, S.P.; Bittner, M.L.; Brand, L.A.; Fink, C.L.; Fry, J.S.; et al.

Expression of bacterial genes in plant cells. Proc. Natl. Acad. Sci. USA 1983, 80, 4803–4807. [CrossRef] [PubMed]

14.

Herrera-Estrella, L.; De Block, M.; Messens, E.; Hernalsteens, J.P.; Van Montagu, M.; Schell, J. Chimeric genes as dominant

selectable markers in plant cells. EMBO J. 1983, 2, 987–995. [CrossRef] [PubMed]

15.

Sardesai, N.; Subramanyam, S. Agrobacterium: A genome-editing tool-delivery system. Curr. Top. Microbiol. Immunol.

2018

, 418,

463–488. [CrossRef]

16.

Park, S.H.; Morris, J.L.; Park, J.E.; Hirschi, K.D.; Smith, R.H. Efﬁcient and genotype-independent Agrobacterium-mediated tomato

transformation. J. Plant Physiol. 2003, 160, 1253–1257. [CrossRef]

17.

Cortina, C.; Culiáñez-Macià, F.A. Tomato transformation and transgenic plant production. Plant Cell Tissue Organ Cult.

2004

, 76,

269–275. [CrossRef]

18.

Shan, Q.; Wang, Y.; Li, J.; Zhang, Y.; Chen, K.; Liang, Z.; Zhang, K.; Liu, J.; Xi, J.J.; Qiu, J.L.; et al. Targeted genome modiﬁcation of

crop plants using a CRISPR-Cas system. Nat. Biotechnol. 2013, 31, 686–688. [CrossRef]

19.

Brooks, C.; Nekrasov, V.; Lippman, Z.B.; Van Eck, J. Efﬁcient gene editing in tomato in the ﬁrst generation using the clustered

regularly interspaced short palindromic repeats/CRISPR-associated9 system. Plant Physiol.

2014

, 166, 1292–1297. [CrossRef]

[PubMed]

20.

Butler, N.M.; Baltes, N.J.; Voytas, D.F.; Douches, D.S. Geminivirus-mediated genome editing in potato (Solanum tuberosum L.)

using sequence-speciﬁc nucleases. Front. Plant Sci. 2016, 7, 1045. [CrossRef] [PubMed]

21.

Gammoudi, N.; Pedro, T.S.; Ferchichi, A.; Gisbert, C. Improvement of regeneration in pepper: A recalcitrant species. In Vitro Cell.

Dev. Biol. Plant 2018, 54, 145–153. [CrossRef]

22.

Xu, J.; Kang, B.C.; Naing, A.H.; Bae, S.J.; Kim, J.S.; Kim, H.; Kim, C.K. CRISPR/Cas9-mediated editing of 1-aminocyclopropane-1-

carboxylate oxidase1 enhances Petunia ﬂower longevity. Plant Biotechnol. J. 2020, 18, 287–297. [CrossRef] [PubMed]

23.

Han, K.; Jang, S.; Lee, J.H.; Lee, D.G.; Kwon, J.K.; Kang, B.C. A MYB transcription factor is a candidate to control pungency in

Capsicum annuum. Theor. Appl. Genet. 2019, 132, 1235–1246. [CrossRef] [PubMed]

24. Pickersgill, B. Genetic resources and breeding of Capsicum spp. Euphytica 1997, 96, 129–133. [CrossRef]

25.

Li, D.; Zhao, K.; Xie, B.; Zhang, B.; Luo, K. Establishment of a highly efficient transformation system for pepper

(Capsicum annuum L.).

Plant Cell Rep. 2003, 21, 785–788. [CrossRef]

26.

Lee, Y.H.; Kim, H.S.; Kim, J.Y.; Jung, M.; Park, Y.S.; Lee, J.S.; Choi, S.H.; Her, N.H.; Lee, J.H.; Hyung, N.I.; et al. A new selection

method for pepper transformation: Callus-mediated shoot formation. Plant Cell Rep. 2004, 23, 50–58. [CrossRef]

27.

Kumar, R.V.; Sharma, V.K.; Chattopadhyay, B.; Chakraborty, S. An improved plant regeneration and Agrobacterium-mediated

transformation of red pepper (Capsicum annuum L.). Physiol. Mol. Biol. Plants 2012, 18, 357–364. [CrossRef] [PubMed]

28.

Bagga, S.; Lucero, Y.; Apodaca, K.; Rajapakse, W.; Lujan, P.; Ortega, J.L.; Sengupta-Gopalan, C. Chile (Capsicum annuum) plants

transformed with the RB gene from Solanum bulbocastanum are resistant to Phytophthora capsici. PLoS ONE

2019

, 14, e0223213.

[CrossRef]

29.

Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A programmable dual RNA-guided DNA

endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [CrossRef]

30.

Zetsche, B.; Gootenberg, J.S.; Abudayyeh, O.O.; Slaymaker, I.M.; Makarova, K.S.; Essletzbichler, P.; Volz, S.E.; Joung, J.; van der

Oost, J.; Regev, A.; et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell

2015

, 163, 759–771.

[CrossRef]

31.

Gaudelli, N.M.; Komor, A.C.; Rees, H.A.; Packer, M.S.; Badran, A.H.; Bryson, D.I.; Liu, D.R. Programmable base editing of A

•

T to

G•C in genomic DNA without DNA cleavage. Nature 2017, 551, 464–471. [CrossRef]

32.

Anzalone, A.V.; Randolph, P.B.; Davis, J.R.; Sousa, A.A.; Koblan, L.W.; Levy, J.M.; Chen, P.J.; Wilson, C.; Newby, G.A.;

Raguram, A.

;

et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 2019, 576, 149–157. [CrossRef]

33.

Holsters, M.; Silva, B.; Van Vliet, F.; Genetello, C.; De Block, M.; Dhaese, P.; Depicker, A.; Inzé, D.; Engler, G.; Villarroel, R.; et al.

The functional organization of the nopaline A. tumefaciens plasmid pTiC58. Plasmid 1980, 3, 212–230. [CrossRef]

34.

Hoekema, A.; Hirsch, P.R.; Hooykaas, P.J.J.; Schilperoort, R.A. A binary plant vector strategy based on separation of vir- and

T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 1983, 303, 179–180. [CrossRef]

35.

Hood, E.E.; Helmer, G.L.; Fraley, R.T.; Chilton, M.D. The hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region

of pTiBo542 outside of T-DNA. J. Bacteriol. 1986, 168, 1291–1301. [CrossRef] [PubMed]

Int. J. Mol. Sci. 2021, 22, 3921 12 of 12

36.

Hood, E.E.; Gelvin, S.B.; Melchers, L.S.; Hoekema, A. New Agrobacterium helper plasmids for gene transfer to plants. Transgenic

Res. 1993, 2, 208–218. [CrossRef]

37.

Hellens, R.; Mullineaux, P.; Klee, H. Technical focus: A guide to Agrobacterium binary Ti vectors. Trends Plant Sci.

2000

, 5, 446–451.

[CrossRef]

38.

El-Nagar, M.M. Somatic embryogenesis of pepper (Capsicum annuum L.) and regeneration of transgenic plants after Agrobacterium-

mediated transformation. J. Appl. Sci. Res. 2012, 8, 5550–5563.

39.

Mihálka, V.; Fári, M.; Szász, A.; Balázs, E.; Nagy, I. Optimized protocols for efﬁcient plant regeneration and gene transfer in

pepper (Capsicum annuum L.). J. Plant Biotechnol. 2000, 2, 143–149.

40.

Kim, H.; Kim, S.T.; Ryu, J.; Choi, M.K.; Kweon, J.; Kang, B.C.; Ahn, H.M.; Bae, S.; Kim, J.; Kim, J.S.; et al. A simple, ﬂexible

and high-throughput cloning system for plant genome editing via CRISPR-Cas system. J. Integr. Plant Biol.

2016

, 58, 705–712.

[CrossRef] [PubMed]

41.

Kim, H.; Lim, J. Leaf-induced callus formation in two cultivars: Hot pepper ’CM334’ and bell pepper ‘Dempsey’. Plant Signal.

Behav. 2019, 14, 1604016. [CrossRef] [PubMed]

42.

Hwang, H.H.; Wu, E.T.; Liu, S.Y.; Chang, S.C.; Tzeng, K.C.; Kado, C.I. Characterization and host range of ﬁve tumorigenic

Agrobacterium tumefaciens strains and possible application in plant transient transformation assays. Plant Pathol.

2013

, 62,

1384–1397. [CrossRef]

43.

Dabauza, M.; Peña, L. Response of sweet pepper (Capsicum annuum L.) genotypes to Agrobacterium tumefaciens as a means of

selecting proper vectors for genetic transformation. J. Hortic. Sci. Biotechnol. 2003, 78, 39–45. [CrossRef]

44.

Gelvin, S.B. Agrobacterium transformation of Arabidopsis thaliana roots: A quantitative assay. Methods Mol. Biol.

2006

, 343, 105–114.

[CrossRef]

45.

Olhoft, P.M.; Donovan, C.M.; Somers, D.A. Soybean (Glycine max) transformation using mature cotyledonary node explants.

Methods Mol. Biol. 2006, 343, 385–396. [CrossRef] [PubMed]

46.

Kim, D.S.; Hwang, B.K. The pepper MLO gene, CaMLO2, is involved in the susceptibility cell-death response and bacterial and

oomycete proliferation. Plant J. 2012, 72, 843–855. [CrossRef]

47.

Lane, R.P.; McCarter, S.M.; Kuhn, C.W.; Deom, C.M. ’Dempsey’, a virus- and bacterial spot-resistant bell pepper. Hort. Sci.

1997

32, 333–334. [CrossRef]

48.

Porebski, S.; Bailey, L.G.; Baum, B.R. Modiﬁcation of a CTAB DNA extraction protocol for plants containing high polysaccharide

and polyphenol components. Plant Mol. Biol. Rep. 1997, 15, 8–15. [CrossRef]

49.

Park, J.; Lim, K.; Kim, J.S.; Bae, S. Cas-analyzer: An online tool for assessing genome editing results using NGS data. Bioinformatics

2017, 33, 286–288. [CrossRef]